КОНСТРУИРОВАНИЕ ПРАЙМЕРОВ И ОПТИМИЗАЦИЯ ПАРАМЕТРОВ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ ДЛЯ РАЗРАБОТКИ ОТЕЧЕСТВЕННЫХ ТЕСТ-СИСТЕМ ДЛЯ ДИАГНОСТИКИ СЕПТОРИОЗА ЗЛАКОВЫХ КУЛЬТУР МЕТОДОМ ПЦР В РЕЖИМЕ РЕАЛЬНОГО ВРЕМЕНИ - Студенческий научный форум

VII Международная студенческая научная конференция Студенческий научный форум - 2015

КОНСТРУИРОВАНИЕ ПРАЙМЕРОВ И ОПТИМИЗАЦИЯ ПАРАМЕТРОВ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ ДЛЯ РАЗРАБОТКИ ОТЕЧЕСТВЕННЫХ ТЕСТ-СИСТЕМ ДЛЯ ДИАГНОСТИКИ СЕПТОРИОЗА ЗЛАКОВЫХ КУЛЬТУР МЕТОДОМ ПЦР В РЕЖИМЕ РЕАЛЬНОГО ВРЕМЕНИ

Качина В.А. 1
1Костанайский государственный университет имени А. Байтурсынова
 Комментарии
Текст работы размещён без изображений и формул.
Полная версия работы доступна во вкладке "Файлы работы" в формате PDF

ВВЕДЕНИЕ

Актуальность темы. На территории Республики Казахстан, как и во многих других странах мира, септориоз относится к особо опасным болезням зерновых культур. Вызывается данное заболевание грибами Septoria tritici и Septoria nodorum. Поражение верхних ярусов листьев растений пшеницы грибами рода Septoria вызывает значительную потерю урожайности (до 40-50% при эпифитотиях). Погодно-климатические условия Казахстана благоприятствуют развитию и распространению септориоза, снижая рентабельность зернового производства. Согласно Постановлению Правительства Республики Казахстан от 10 декабря 2002 годя № 1295 «Об утверждении перечней карантинных объектов и особо опасных вредных организмов» (с изменениями и дополнениями от 23. 11. 2005 г.), в «Перечень особо опасных вредителей и болезней сельскохозяйственных растений» был включен септориоз зерновых культур.

Ежегодный ущерб, наносимый вредителями и болезнями с.-х. культурам, по данным организации по продовольствию и сельскому хозяйству ООН (ФАО), составляет примерно 20-25% потенциального мирового урожая продовольственных культур. Поэтому роль защиты растений в увеличении производства и сохранении сельскохозяйственных продуктов огромна [1].

Принятая в Республике Казахстан система мониторинга и защиты растений от особо опасных болезней использует несовершенную методику полевых обследований с визуальным диагностированием и не охватывает даже половину посевных площадей, что приводит к ошибочным диагнозам и снижению рентабельности зернового производства. Существует ряд биотических и абиотических заболеваний с идентичными признаками проявления.

Молекулярно-генетические методы исследований заболеваний злаковых культур актуальны и проводятся во всем мире, так, например, в Соединенных Штатах Америки проводились исследования по идентификации и картированию микросателлитных локусов из базы данных EST Septoria tritici, возбудителя Mycosphaerella graminicola [2], группа ученых исследовала специфичность и чувствительность ПЦР диагностики Septoria musiva, S. populicola и S. Populi [3], в Китае совместно с США проводились исследования по проектирования ПЦР праймеров для диагностики фитопатогенных грибов [4].

Создание отечественной тест-системы для диагностики септориоза злаковых культур является актуальной задачей современной казахстанской науки и обусловлено необходимостью ранней диагностики заболевания [5].

Традиционные методы комплексной диагностики, включающие выделение видов в чистую культуру, подбор сред и условий культивирования, получение моноспоровых изолятов и микроскопия, длительны, трудоемки и недостаточно эффективны. Иммуноферментный метод анализа занимает несколько часов, однако разработанные на его основе методики видоспецифического, пресимптоматического и количественного определения S.tritici и S.nodorum в листьях и семенах пшеницы недостаточно чувствительны и не всегда обеспечивают четкую идентификацию этих видов.

Внедрение экспресс-методов диагностики септориоза на основе полимеразной цепной реакции (ПЦР) в модификации Real-time позволит быстро и точно диагностировать развитие болезни.

Метод полимеразной цепной реакции (ПЦР) по сравнению с микробиологическими методами более чувствителен и специфичен, а его модификация в формате Real-time с использованием гибридизационного зонда с флуоресцентной меткой позволяет быстро анализировать результаты, не проводя электрофореза. Принципиальной особенностью ПЦР в реальном времени также является - мониторинг и количественный анализ накопления продуктов полимеразной цепной реакции, автоматическая регистрация и интерпретация полученных результатов. Благодаря экономии производственных площадей, уменьшению количества персонала и востребованости количественного определения ДНК/РНК этот метод в последние годы успешно применяется в крупнейших диагностических и научно-исследовательских центрах развитых стран мира.

Данная научная работа является частью научного проекта: «Разработка отечественных тест-систем на основе полимеразой цепной реакции (ПЦР) в реальном времени для диагностики септориоза злаковых культур» № гос.регистрации 0113РК00768.

Целью научной работы является конструирование праймеров и оптимизация параметров полимеразной цепной реакции для разработки отечественных тест-систем для диагностики септориоза злаковых культур методом ПЦР в режиме реального времени.

Для достижения поставленной цели необходимо решить следующие задачи:

1. Получение праймеров для идентификации и диагностики септориоза злаковых культур на основе полимеразной цепной реакции (ПЦР) в реальном времени.

2. Отработка и оптимизация параметров ПЦР.

3. Определение чувствительности и специфичности разработанной ПЦР.

ОСНОВНАЯ ЧАСТЬ

1 Выбор направления исследований

Продовольственная и биологическая безопасность страны во многом зависит от четкого и своевременного контроля над фито санитарным состоянием окружающей среды и сельскохозяйственных растений, а также продуктов их переработки и кормов. Основным подходом для осуществления такого контроля является эффективная диагностика и идентификация фитопатогенов. Особое внимание должно уделяться диагностике патогенов, являющихся объектами внутреннего и внешнего карантина Республики Казахстан, а также особо опасным патогенам.

Постоянно развивающиеся системы диагностики фитопатогенов можно разделить на две группы: системы, основанные на традиционных методах (визуальная диагностика болезни по симптомам и по морфологии возбудителя, микроскопия, использование растений-индикаторов) и более современных молекулярных технологиях, большинство последних диагностикумов базируется на двух принципиально разных технологиях — иммуноферментном анализе (ИФА) и полимеразной цепной реакции (ПЦР) — хотя нередко применяются и другие подходы [6, 7].

Каждая из перечисленных технологий имеет как преимущества, так и недостатки. В то же время современные диагностические системы, нового поколения должны характеризоваться следующими качествами: высокой чувствительностью; высокой специфичностью; максимальной автоматизацией и стандартизацией большинства этапов анализа; уменьшением вероятности субъективной оценки результатов за счет автоматизации и снижения роли человеческого фактора; высокой производительностью системы при низкой себестоимости выполнения анализа; общим сокращением количества манипуляций в пределах каждого этапа анализа; компьютеризацией этапов ввода и вывода данных анализов; совместимостью с программным обеспечением по статистической обработке результатов. Для того, чтобы современные диагностические системы соответствовали всем выше перечисленным требованиям, в настоящее время Европейский Союз, а также Европейская и Средиземноморская Организация по Защите Растений (ЕРРО — European and Mediterranean Plant Protection organisation) рекомендуют использовать комбинации методов, включающих наряду с традиционными и молекулярные методы, особенно при диагностике карантинных организмов [8, 9, 10].

Практическая значимость работы определяется тем, что созданные тест-системы просты и удобны для рутинного применения и позволяют с высокой чувствительностью и специфичностью определять детектируемые фитопатогены.

2 Материалы и методы исследований

В исследовании было проанализировано:

- 3 штамма 2 видов грибов рода Septoria из коллекций НИИЗР (г. Алматы);

- 68 образцов зараженной пшеницы, охарактеризованного по степени инфицированности грибами рода Septoria.

Выделение ДНК из моноспоровых культур грибов и искусственно заражённых проростков пшеницы проводили по методу, основанному на использовании цетилтриметиламмоний бромида (ЦТАБ) в качестве детергента с некоторыми модификациями. Для получения обильного мицелия культуры грибов пересевали на чашки Петри с картофельно-сахарозным агаром (КСА), и выращивали в темноте в течение 7-10 суток. Мицелий, отобранный микробиологической петлёй с чашек Петри, гомогенизировали в предварительно прогретом до 65ºС лизирующем буфере (1М Трис-НСl, рН 7.5; 5М NaCl; 0.5М ЕDTA, pH 8.0; 2% ЦТАБ; 1% меркаптоэтанол) (соотношение 100 мг мицелия : 5 мл буфера). Гомогенат инкубировали при 65ºС в течение 1.5 часов, периодически встряхивая. Затем добавляли равный объём хлороформа, перемешивали и центрифугировали при 5000 об/мин в течение 10 мин. Верхнюю фазу переносили в чистую пробирку, добавляли к ней равный объём изопропанола, перемешивали и инкубировали при -20°С 30 минут, после чего центрифугировали при 5000 об/мин в течение 20 мин. Удаляли супернатант, осадок промывали 70% этанолом и растворяли в 500 мкл MilliQ, добавляли 1 мкл РНКзы А (10мг/мл), инкубировали при 37°С 30 мин. Затем последовательно добавляли равные объёмы (500 мкл) фенола и хлороформа, центрифугировали при 13000 об/мин в течение 5 мин., после чего содержащую ДНК верхнюю фазу переносили в чистые пробирки, и преципитировали 96% этанолом в присутствии 1/10 объёма 3М ацетата натрия. Центрифугировали, отбирали супернатант, осадок растворяли в 100 мкл MilliQ.

Концентрации ДНК определяли на спектрофотометре NanoVue. Перед внесением в реакционную смесь ДНК, выделенная из моноспоровых культур, разбавлялась до 10 нг/мкл.

Поиск последовательностей генов для подбора универсальных праймеров производился в GenBank NCBI (http://www.ncbi.nlm.nih.gov/GenBank). Выравнивания нуклеотидных последовательностей проводили с использованием алгоритма Clustal W. Оценки характеристик праймеров и зондов проводили с помощью программы Oligo 6.71. Все праймеры синтезированы ЗАО «Евроген»; все флуоресцентно-меченые зонды синтезированы ЗАО «НПФ ДНК-технология».

Во всех экспериментах использовался один и тот же состав реакционной смеси (за исключением праймеров, и, где это было необходимо, зондов).

Объём универсальной реакционной смеси составил 35 мкл, в которых содержалось: 3.5 мкл 10Х ПЦР-буфера (750 мМ Трис-HCl, рН 8.8, 200 мМ сульфат аммония, 0.1% Твин-20), 1 мМ каждого dNTP, 1 мкМ праймеров, 2.5 ед. Taq-полимеразы и 5 мкл раствора выделенной ДНК. При проведении ПЦР-РВ в реакционную смесь также добавлялось по 0.1-0.2 мкМ зондов типа TaqMan.

При тестировании специфических праймеров в реакционную смесь также добавляли внутренний контроль (ВК). В качестве ВК использовали плазмидную конструкцию со вставкой размером 560 п.о., фланкированную инвертированными последовательностями, гомологичными 1 праймеру, используемому для амплификации ВК. Зонд для ВК также представлял собой TaqMan, однако был мечен другим флуорофором (HEX).

ПЦР проводили в соответствии со следующими программами амплификации:

Для универсальных праймеров:

- Для пар праймеров бета-тубулина и ITS1-2: 94ºС - 60 с; 94ºС – 10 с, 64ºС – 20 с; 67ºC – 20 c (50 циклов).

Детекция результатов ПЦР методом гель-электрофореза. Электрофорез проводили при силе тока 400 mA в 2.5% агарозном геле в буфере TAE (40 мМ трисгидроксиметиламинометан, 20 мМ ледяная уксусная кислота, 1 мМ ЭДТА), с добавлением 0.5 мкг/мл бромистого этидия. Для оценки молекулярного веса фрагментов использовали маркеры молекулярного веса ДНК 500 bp GeneRuler и 1 kb GeneRuler. Результаты электрофореза визуализировали на трансиллюминаторе ECX-15-M (Viber-Lourmat, Франция) [10].

Детекция результатов на амплификаторе ДТ-96. По мере протекания реакции для каждого образца определялась зависимость уровня флуоресценции от номера цикла, и при помощи прилагаемого к амплификатору программного обеспечения строился соответствующий график. Для определения значений Cq использовался пороговый метод анализа [11].

В работе было использовано следующее оборудование:

Детектирующий амплификатор ДТ-96, амплификатор «Терцик», термостат «Гном», термостат «Термит» (ЗАО «НПФ ДНК-технология», Россия); спектрофотометр NanoVue, источник постоянного тока EPS-300 («GE Healthcare», США); насос с колбой-ловушкой («Литех», Россия); центрифуга-вортекс Microspin FV-2400 («Biosan», Литва); шейкер-инкубатор G24 Enviromental incubator-shaker («New Brunswick Scientific», США); автоклав MLS-2420U («Sanyo», Япония); водяная баня J12 («Jouan», Франция); трансиллюминатор ECX-15M («Vilber-Lourmat, Франция); камера для горизонтального электрофореза SE-2, система гель-документирования GelImager2 («Хеликон», Россия); настольная центрифуга MiniSpin, центрифуга Centrifuge 5810R («Eppendorf», Германия); pH-метр PB-11 («Sartorius AG», Германия); весы электронные SPO-51 («Scaltec», США).

3 Результаты исследований

3.1 Подбор специфичных праймеров для идентификации Septoria tritici и Stagonospora nodorum

После анализа последовательностей ДНК в базе данных NCBI для подбора специфичных праймеров были выбраны три гена «домашнего хозяйства»: ген фактора элонгации трансляции 1 альфа, ген бета-тубулина и внутренние транскрибируемые спейсеры 1 и 2 гена рибосомальной РНК. Выравнивания участков генов бета-тубулина и ITS1-2 приведено на рисунках 1-2.

1051 1125

AJ310917_ST (1036) ACCCATCATACGGCGATCTCAACCACCTCGTCTCCGCCGTCATGTCCGGTGTCACCACCTGCCTGCGCTTCCCCG

AY547264_ST (1041) ACCCATCATACGGCGATCTCAACCACCTCGTCTCCGCCGTCATGTCCGGTGTCACCACCTGCCTGCGCTTCCCCG

JF807057_ST (275) ACCCATCATACGGCGATCTCAACCACCTCGTCTCCGCCGTCATGTCCGGTGTCACCACCTGCCTGCGCTTCCCCG

DQ026324_ST (308) ACCCCTCCTACGGCGATCTCAACCACCTCGTCTCCGCCGTCATGTCCGGTGTCACCACCTGCCTGCGCTTCCCCG

XM_003856727_ST (697) ACCCCTCCTACGGCGATCTCAACCACCTCGTCTCCGCCGTCATGTCCGGTGTCACCACCTGCCTGCGCTTCCCCG

AY786332_SN (868) ACCCTTCATACGGTGACCTGAACCACCTCGTTTCCGCCGTCATGTCGGGTGTCACCACCTGCCTGCGTTTCCCTG

AY786331_SN (869) ACCCCTCATACGGTGACCTGAACCACCTGGTTTCCGCCGTCATGTCGGGTGTCACCACCTGCCTGCGTTTCCCCG

AY786335_SN (868) ACCCCTCATACGGTGACCTGAACCACCTGGTTTCCGCCGTCATGTCGGGTGTCACCACCTGCCTGCGTTTCCCCG

AY786337_SN (868) ACCCCTCATACGGTGACCTGAACCACCTGGTTTCCGCCGTCATGTCGGGTGTCACCACCTGCCTGCGTTTCCCCG

AY786339_SN (868) ACCCCTCATACGGTGACCTGAACCACCTGGTTTCCGCCGTCATGTCGGGTGTCACCACCTGCCTGCGTTTCCCCG

AY786334_SN (868) ACCCCTCATACGGTGACCTGAACCACCTGGTTTCCGCCGTCATGTCGGGTGTCACCACCTGCCTGCGTTTCCCCG

AY786338_SN (868) ACCCCTCATACGGTGACCTGAACCACCTGGTTTCCGCCGTCATGTCGGGTGTCACCACCTGCCTGCGTTTCCCCG

AY786336_SN (868) ACCCCTCATACGGTGACCTGAACCACCTGGTTTCCGCCGTCATGTCGGGTGTCACCACCTGCCTGCGTTTCCCCG

AY823526_SN (868) ACCCCTCATACGGTGACCTGAACCACCTGGTTTCCGCCGTCATGTCGGGTGTCACCACCTGCCTGCGTTTCCCCG

1126 1200

AJ310917_ST (1111) GTCAGCTCAACAACGATCTCCGCAAGCTCGCCGTCAACATGGTGCCCTTCCCGCGTCTCCACTTCTTCATGGTCG

AY547264_ST (1116) GTCAGCTCAACAGCGATCTCCGCAAGCTCGCCGTCAACATGGTGCCCTTCCCGCGTCTCCACTTCTTCATGGTCG

JF807057_ST (350) GTCAGCTCAACAGCGATCTCCGCAAGCTCGCCGTCAACATGGTGCCCTTCCCGCGTCTCCACTTCTTCATGGTCG

DQ026324_ST (383) GTCAGCTCAACAGCGATCTCCGCAAGCTCGCCGTCAACATGGTGCCCTTCCCGCGTCTCCACTTCTTCATGGTCG

XM_003856727_ST (772) GTCAGCTCAACAGCGATCTCCGCAAGCTCGCCGTCAACATGGTGCCCTTCCCGCGTCTCCACTTCTTCATGGTCG

AY786332_SN (943) GTCAGCTCAACTCTGACCTAAGGAAGTTGGCCGTCAACATGGTGCCCTTCCCCCGTCTCCACTTCTTCATGGTCG

AY786331_SN (944) GTCAGCTCAACTCTGACCTGAGGAAGTTGGCCGTCAACATGGTGCCCTTCCCCCGTCTCCACTTCTTCATGGTCG

AY786335_SN (943) GTCAGCTCAACTCTGACCTGAGGAAGTTGGCCGTCAACATGGTGCCCTTCCCCCGTCTCCACTTCTTCATGGTCG

AY786337_SN (943) GTCAGCTCAACTCTGACCTGAGGAAGTTGGCCGTCAACATGGTGCCCTTCCCCCGTCTCCACTTCTTCATGGTCG

AY786339_SN (943) GTCAGCTCAACTCTGACCTGAGGAAGTTGGCCGTCAACATGGTGCCCTTCCCCCGTCTCCACTTCTTCATGGTCG

AY786334_SN (943) GTCAGCTCAACTCTGACCTGAGGAAGTTGGCCGTCAACATGGTGCCCTTCCCCCGTCTCCACTTCTTCATGGTCG

AY786338_SN (943) GTCAGCTCAACTCTGACCTGAGGAAGTTGGCCGTCAACATGGTGCCCTTCCCCCGTCTCCACTTCTTCATGGTCG

AY786336_SN (943) GTCAGCTCAACTCTGACCTGAGGAAGTTGGCCGTCAACATGGTGCCCTTCCCCCGTCTCCACTTCTTCATGGTCG

AY823526_SN (943) GTCAGCTCAACTCTGACCTGAGGAAGTTGGCCGTCAACATGGTGCCCTTCCCCCGTCTCCACTTCTTCATGGTCG

1201 1275

AJ310917_ST (1186) GTTTCGCTCCTCTCACCAGCCGTGGCGCCCACTCCTTCCGCGCCGTCACCGTCCCCGAGCTCACCCAGCAAATCT

AY547264_ST (1191) GTTTCGCTCCTCTCACCAGCCGTGGCGCCCACTCCTTCCGCGCCGTCACCGTCCCCGAGCTCACCCAGCAAATCT

JF807057_ST (425) GTTTCGCTCCTCTCACCAGCCGTGGCGCCCACTCCTTCCGCGCCGTCACCGTCCCCGAGCTCACCCAGCAAATCT

DQ026324_ST (458) GTTTCGCTCCTCTCACCAGCCGTGGCGCCCACTCCTTCCGCGCCGTCACCGTCCCTGAGCTCACCCAGCAAATCT

XM_003856727_ST (847) GTTTCGCTCCTCTCACCAGCCGTGGCGCCCACTCCTTCCGCGCCGTCACCGTCCCTGAGCTCACCCAGCAAATCT

AY786332_SN (1018) GTTTCGCTCCTCTGACCAGCCGTGGCGCCCACTCTTTCCGTGCCGTCACCGTCCCCGAGCTCACCCAGCAGATGT

AY786331_SN (1019) GTTTCGCTCCTCTGACCAGCCGTGGCGCGCACTCCTTCCGTGCTGTCACCGTTCCTGAGCTCACTCAGCAGATGT

AY786335_SN (1018) GTTTCGCTCCTCTGACCAGCCGTGGCGCGCACTCCTTCCGTGCTGTCACCGTCCCTGAGCTCACTCAGCAGATGT

AY786337_SN (1018) GTTTCGCCCCTCTGACCAGCCGTGGCGCGCACTCCTTCCGTGCTGTCACCGTCCCTGAGCTCACCCAGCAGATGT

AY786339_SN (1018) GTTTCGCCCCTCTGACCAGCCGTGGCGCGCACTCCTTCCGTGCTGTCACCGTCCCTGAGCTCACCCAGCAGATGT

AY786334_SN (1018) GTTTCGCCCCTCTGACCAGCCGTGGCGCGCACTCCTTCCGTGCTGTCACCGTCCCTGAGCTCACCCAGCAGATGT

AY786338_SN (1018) GTTTCGCCCCTCTGACCAGCCGTGGCGCGCACTCCTTCCGTGCTGTCACCGTCCCTGAGCTCACCCAGCAGATGT

AY786336_SN (1018) GTTTCGCCCCTCTGACCAGCCGTGGCGCGCACTCCTTCCGTGCTGTCACCGTCCCTGAGCTCACCCAGCAGATGT

AY823526_SN (1018) GTTTCGCCCCTCTGACCAGCCGTGGCGCGCACTCCTTCCGTGCTGTCACCGTCCCTGAGCTCACCCAGCAGATGT

1276 1350

AJ310917_ST (1261) TCGACCCCAAGAACATGATGGCCGCCAGCGATTTCCGCAACGGTCGTTACCTCACCTGCTCCGCCATCTACCGCG

AY547264_ST (1266) TCGACCCCAAGAACATGATGGCCGCCAGCGATTTCCGCAACGGTCGTTACCTCACCTGCTCCGCCATCTACCGCG

JF807057_ST (500) TCGACCCCAAGAACATGATGGCCGCCAGCGATTTCCGCAACGGTCGTTACCTCACCTGCTCCGCCATCTACCGCG

DQ026324_ST (533) TCGACCCTAAGAACATGATGGCCGCCAGCGACTTCCGCAACGGTCGTTACCTCACCTGCTCCGCCATCTACCGCG

XM_003856727_ST (922) TCGACCCTAAGAACATGATGGCCGCCAGCGACTTCCGCAACGGTCGTTACCTCACCTGCTCCGCCATCTACCGCG

AY786332_SN (1093) TCGACCCCAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGTCGCTACCTGACCTGCTCTGCCTACTTCCGTG

AY786331_SN (1094) TCGACCCCAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGTCGCTACCTGACCTGCTCCGCCTACTTCCGTG

AY786335_SN (1093) TCGACCCCAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGTCGCTACCTGACCTGCTCCGCCTACTTCCGTG

AY786337_SN (1093) TCGACCCCAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGTCGCTACCTGACCTGCTCCGCTTACTTCCGCG

AY786339_SN (1093) TCGACCCCAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGTCGCTACCTGACCTGCTCCGCTTACTTCCGCG

AY786334_SN (1093) TCGACCCCAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGTCGCTACCTGACCTGCTCCGCTTACTTCCGCG

AY786338_SN (1093) TCGACCCCAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGTCGCTACCTGACCTGCTCCGCTTACTTCCGCG

AY786336_SN (1093) TCGACCCCAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGTCGCTACCTGACCTGCTCCGCTTACTTCCGCG

AY823526_SN (1093) TCGACCCCAAGAACATGATGGCTGCCTCTGACTTCCGCAACGGTCGCTACCTGACCTGCTCCGCTTACTTCCGCG

1351 1425

AJ310917_ST (1336) GAAAGGTGTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACCGCATACTTCGTCGAGT

AY547264_ST (1341) GAAAGGTGTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACCGCATACTTCGTCGAGT

JF807057_ST (575) GAAAGGTGTCCATGAAGGAGGTCGAGGACCAGATCCGCAACGTGCAGAACAAGAACACCGCATACTTCGTCGAGT

DQ026324_ST (608) GAAAGGTGTCCATGAAGGAGGTTGAGGACCAGATCCGCAACGTGCAGAACAAGAACACCGCCTACTTCGTCGAGT

XM_003856727_ST (997) GAAAGGTGTCCATGAAGGAGGTTGAGGACCAGATCCGCAACGTGCAGAACAAGAACACCGCCTACTTCGTCGAGT

AY786332_SN (1168) GAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCCTACTTCGTTGAGT

AY786331_SN (1169) GAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCCTACTTCGTTGAGT

AY786335_SN (1168) GAAAGGTCTCCATGAAGGAGGTCGAGGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCCTACTTCGTTGAGT

AY786337_SN (1168) GAAAGGTCTCCATGAAGGAGGTCGAAGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCCTACTTCGTTGAGT

AY786339_SN (1168) GAAAGGTCTCCATGAAGGAGGTCGAAGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCCTACTTCGTTGAGT

AY786334_SN (1168) GAAAGGTCTCCATGAAGGAGGTCGAAGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCCTACTTCGTTGAGT

AY786338_SN (1168) GAAAGGTCTCCATGAAGGAGGTCGAAGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCCTACTTCGTTGAGT

AY786336_SN (1168) GAAAGGTCTCCATGAAGGAGGTCGAAGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCCTACTTCGTTGAGT

AY823526_SN (1168) GAAAGGTCTCCATGAAGGAGGTCGAAGACCAGATGCGCAACGTCCAGAACAAGAACTCGTCCTACTTCGTTGAGT

1426 1500

AJ310917_ST (1411) GGATCCCGAACAACGTCCAGACCGCGCTGTGCTCCATTCCTCCC-CGTGGATTGAAGATGTCGTCCACCTTCGTC

AY547264_ST (1416) GGATCCCGAACAACGTCCAGACCGCTCTGTGCTCCATTCCTCCC-CGTGGATTGAAGATGTCGTCCACCTTCGTC

JF807057_ST (650) GGATTCCGAACAACGTCCAGACCGCTCTGTGCTCCATTCCTCCTTCCTGGATTGAAGAC-TCGTCCACCTTGGTC

DQ026324_ST (683) GGATTCCGAACAACGTCCAGACCGCTCTGTGCTCCATTCCTCCA-CGTGGATTGAAGATGTCATCGACCTTCGTC

XM_003856727_ST (1072) GGATTCCGAACAACGTCCAGACCGCTCTGTGCTCCATTCCTCCA-CGTGGATTGAAGATGTCATCGACCTTCGTC

AY786332_SN (1243) GGATCCCCAACAACGTCCAGACCGCTCTCTGCTCCGTGCCCCCG-CGTGGTCTCAAGATGTCCGCCACCTTCGTC

AY786331_SN (1244) GGATCCCCAACAACGTCCAGACCGCTCTCTGCTCCGTGCCCCCG-CGTGGTCTCAAGATGTCCGCCACCTTCGTC

AY786335_SN (1243) GGATCCCCAACAACGTCCAGACCGCTCTCTGCTCCGTGCCCCCG-CGTGGTCTCAAGATGTCCGCCACCTTCGTC

AY786337_SN (1243) GGATCCCCAACAACGTCCAGACCGCTCTCTGCTCCGTGCCCCCG-CGTGGTCTCAAGATGTCCGCCACCTTCGTC

AY786339_SN (1243) GGATCCCCAACAACGTCCAGACCGCTCTCTGCTCCGTGCCCCCG-CGTGGTCTCAAGATGTCCGCCACCTTCGTC

AY786334_SN (1243) GGATCCCCAACAACGTCCAGACCGCTCTCTGCTCCGTGCCCCCG-CGTGGTCTCAAGATGTCCGCCACCTTCGTC

AY786338_SN (1243) GGATCCCCAACAACGTCCAGACCGCTCTCTGCTCCGTGCCCCCG-CGTGGTCTCAAGATGTCCGCCACCTTCGTC

AY786336_SN (1243) GGATCCCCAACAACGTCCAGACCGCTCTCTGCTCCGTGCCCCCG-CGTGGTCTCAAGATGTCCGCCACCTTCGTC

AY823526_SN (1243) GGATCCCCAACAACGTCCAGACCGCTCTCTGCTCCGTGCCCCCG-CGTGGTCTCAAGATGTCCGCCACCTTCGTC

Рисунок 1 - Выравнивание фрагментов генов, кодирующих бета-тубулина у S. tritici и S. nodorum

76 150

PNU04237_SN (66) CGCAAGCTGATGAGCAGCTGGCCTCTTTTATCCACCCTTGTCTTTTGCGGTACCCACGTTTCCTCGGCAGGCTTG

PNU77361_SN (76) CGCAAGCTGATGAGCAGCTGGCCTCTTTTATC-ACCCTTGTCTTTTGCG-TACCCACGTTTCCTCGGCAGGCTTG

PNU77362_SN (76) CGCAAGCTGATGAGCAGCTGGCCTCTTTTATCCACCCTTGTCTTTTGCG-TACCCACGTTTCCTCGGCAGGCTTG

STR300330_ST (68) AGCGAGGGCCTCCGGGTCCGACCTC------CAACCCTT-TGTGAACACATCCCGTTGCTTCGGGGGCGACCCTG

MGU77363_ST (34) AGCGAGGGCCTCCGGGTCCGACCTC------CAACCCTT-TGTGAACACATCCCGTTGCTTCGGGGGCGACCCTG

151 225

PNU04237_SN (141) CCTGCCGGTT--GGACAA--ATTTATAACCTTTTTAATTTTCAATCAGCGTCTGAAAAACTTAAT--AATTACAA

PNU77361_SN (149) CCTGTCGATT--GGACAA--ACCTATAACCTTTTTAAATTTCAATCAGCGTCTGAAAAACTTAAT--AATTACAA

PNU77362_SN (150) CCTGCCGGTT--GGACAA--ATTTATAACCTTTTTAATTTTCAATCAGCGTCTGAAAAACTTAAT--AATTACAA

STR300330_ST (136) CCGGGCGCCCCCGGAGGACCACCAAAAAACACTGCATCTCTGCGTCGGAGTTT--ACGAGTAAATCGAAACAAAA

MGU77363_ST (102) CCGGGCGCCCCCGGAGGACCACCAAAAAACACTGCATCTCTGCGTCGGAGTTT--ACGAGTAAATCGAAACAAAA

226 300

PNU04237_SN (210) CTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAG

PNU77361_SN (218) CTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAG

PNU77362_SN (219) CTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAG

STR300330_ST (209) CTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAG

MGU77363_ST (175) CTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAG

301 375

PNU04237_SN (285) AATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGT

PNU77361_SN (293) AATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGT

PNU77362_SN (294) AATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGT

STR300330_ST (284) AATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCCGTTCGAGCGT

MGU77363_ST (250) AATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCCGTTCGAGCGT

376 450

PNU04237_SN (360) CATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCCTAGTGTTTGGACTCGC--CTTAAAATA

PNU77361_SN (368) CATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCCTAGTGTTTGGACTCGC--CTTAAAACA

PNU77362_SN (369) CATTTGTACCCTCAAGCTCTGCTTGGTGTTGGGTGTTTGTCCTCTCCCTAGTGTTTGGACTCGC--CTTAAAATA

STR300330_ST (359) CATTACACCACTCCAGCCTCGCTGGGTATTGGGCGTCTTTTCGCGGGGGATCACTCCCCCGCGCGCCTCAAAGTC

MGU77363_ST (325) CATTACACCACTCCAGCCTCGCTGGGTATTGGGCGTCTTTTCGCGGGGGATCACTCCCCCGCGCGCCTCAAAGTC

451 525

PNU04237_SN (433) ATTGGCAGCCAGTGTTTTGGTATTGAAGCGCAG---CA-CAAGTCGCGATTCGTAACAAACACTTGCGTCCACAA

PNU77361_SN (441) ATTGGCAGCCAGTGTTTTGGTAGTGAAGCGCAG---CA-CAAGTCGCGATTCTTATTAAATACTTGCGTCCACAA

PNU77362_SN (442) ATTGGCAGCCAGTGTTTTGGTATTGAAGCGCAG---CA-CAAGTCGCGATTCGTAACAAACACTTGCGTCCACAA

STR300330_ST (434) TCCGGCTG--AGCGGTCTCGTCTCCCAGCGTTGTGGCATCACGTCTCGCCGCGGAGTT--CACGAGCCCTCACGG

MGU77363_ST (400) TCCGGCTG--AGCGGTCTCGTCTCCCAGCGTTGTGGCATCACGTCTCGCCGCGGAGTT--CACGAGCCCTCACGG

526 600

PNU04237_SN (504) GCCTT---TTTAACTT----TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAGGCATATCA-TA------

PNU77361_SN (512) GCCTT---TCTAACTT----TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGA

PNU77362_SN (513) GCCTT---TTTAACTT----TTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGA

STR300330_ST (505) CCGTTAAATCACACCTCAGGTTGACCTCGGATCGGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA-----

MGU77363_ST (471) CCGTTAAATCACACCTCAGGTTGACCTCGGATCGGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGA

601

PNU04237_SN (565) ---

PNU77361_SN (580) GGA

PNU77362_SN (581) GGA

STR300330_ST (575) ---

MGU77363_ST (546) GGA

Рисунок 2 - Выравнивание фрагментов генов, кодирующих ITS1, 5.8S рРНК и ITS2 у S. triticiи S. nodorum

К сожалению, те последовательности, которые ранее находились в базе данных NCBI и которые мы использовали для подбора праймеров к гену фактора элонгации трансляции 1 альфа теперь не относят к видам Septoria tritici и Stagonospora nodorum. Поэтому выравнивание этих участков, а также результаты работы с этими праймерами исключены из научной работы.

На участки генов бета-тубулина и ITS1-2 были отобраны пары праймеров и зонд, при отборе старались соблюдать ряд установленных эмпирически требований, выполнение которых позволяет добиться лучшей эффективности и специфичности реакции:

  1. Длина праймеров – 18-30 п.о.

  2. GC-состав праймеров, определяющий Tm (температуру плавления), должен находится в пределах 40-60% (оптимально 45-55%). При этом значения Tm обоих праймеров должны быть близкими.

  3. Концевые 3’-нуклеотиды не должны быть комплементарны самому праймеру, другому праймеру пары, зонду, или другим синтетическим нуклеотидам, добавляемым в реакцию.

  4. Если от праймеров требуется специфичность, то по крайней мере 2 нуклеотида на 3’-концах должны быть гомологичны ДНК анализируемого организма, и не гомологичны ДНК близкородственных организмов.

  5. Желательно, чтобы Tm 5’-концевой части праймера превышала Tm 3’-концевой части.

Оптимальная концентрация праймеров в большинстве случаев составляет 0,1 - 0,5 мкМ. Повышение концентрации праймеров повышает вероятность появления неспецифических продуктов амплификации, в то время как уменьшение приводит к образованию меньшего количества продукта реакции.

Существенно более специфичными являются методы ПЦР-РВ, основанные на использовании флуоресцентно-меченых зондов. В таких случаях помимо флуорофора используется и другое соединение – гаситель флуоресценции (quencher). Эффект гашения флуоресценции, как правило, достигается за счёт тесного сближения флуорофора и гасителя. Наиболее распространёнными системами флуоресцентно-меченых зондов являются TaqMan и «молекулярные маячки» (molecular beacons). Зонд типа TaqMan (линейный разрушаемый зонд, или гидролизующийся зонд, полностью комплементарен продукту ПЦР и имеет Тm порядка 75-80ºС. Свободный зонд, находясь в растворе (гаситель и флуорофор сближены), создаёт некоторый базальный уровень флуоресценции, который преодолевается по мере накопления свободного флуорофора в реакционной смеси. Интенсивность сигнала возрастает пропорционально накоплению специфического продукта реакции. Среди всех систем детекции флуоресценции в формате ПЦР-РВ метод с использованием TaqMan нашёл наиболее широкое применение для детекции возбудителей септориоза.

Во всех вариантах значения флуоресценции зонда ВК превышали в 2.5 раза уровень его фоновой флуоресценции, что свидетельствовало об отсутствии ингибирования ПЦР. В вариантах, где наблюдалось образование специфичного продукта ПЦР, сигнал ВК был меньше в несколько раз, по сравнению с вариантами, в которых образование специфического продукта не происходило.

В таблице 1 приведены последовательности подобранных праймеров и зондов TaqMan.

Таблица 1 - Перечень олигонуклеотидов, подобранных для идентификации S. tritici и S. nodorum

Вид

Локус

Олигонуклеотид

Название

Последовательность, 5'-3'

S. tritici

ITS1-ITS2

st_its180

ACACTGCATCTCTGCGTCGGA

st_its550

CGAGGTCAACCTGAGGTGTGATTT

stn_its330

FAM-TCGAATCTTTGAACGCACATTGCGC-BHQ1

Бета-тубулин

st_tub1120

TCCCCGGTCAGCTCAACAGC

st_tub1430

ATCCACTCGACGAAGTATGCGGT

stn_tub1190

FAM-GTCTCCACTTCTTCATGGTCGGTTTCGC-BHQ1

S. nodorum

ITS1-ITS2

sn_its130

TACCCACGTTTCCTCGGCAG

sn_its550

CTGATCCGAGGTCAAAAGTTAGAAA

stn_its330

FAM-TCGAATCTTTGAACGCACATTGCGC-BHQ1

Бета-тубулин

sn_tub1120

TTCCCCGGTCAGCTCAACTCT

sn_tub1430

GATCCACTCAACGAAGTAGGACGA

stn_tub1190

FAM-GTCTCCACTTCTTCATGGTCGGTTTCGC-BHQ1

Таким образом, для идентификации видов S. tritici и S. nodorum разработаны праймеры и зонд, которые могут послужить основой для создания стандартных наборов для диагностики.

3.2 Проверка специфичности подобранных праймеров и зондов методом ПЦР в «реальном времени» на ДНК, выделенной из культур Septoria tritici и Stagonospora nodorum

Для проверки разработанных праймеров и зондов использовали 6 образцов ДНК Septoria tritici (№1-6)и 8 образцовДНК Stagonospora nodorum (7-14).

На основании выбранных в процессе экспериментов оптимальных параметров времени и температур для всех стадий амплификации, был составлен следующий режим для проведения ПЦР:

пре-денатурация: 1 мин, 94 0С

денатурация: 10 с, 94 0С 50 циклов

отжиг: 20 с, 64 0С

синтез: 20 с, 67 0С

хранение 10 0С

Амплификацию проводили на приборе ДТ-96.

Состав реакционной смеси включал:

18 мкл 1,25х буфера для ПЦР,

0,24 мкл 25 мМ dNTPs,

0,125 мкл каждого праймера (100 мкМ),

0,14 мкл зонда (50 мкМ),

10 мкл раствора Taq-полимеразы,

5 мкл раствора ДНК.

Результаты ПЦР-анализа приведены в таблицах 2 – 4.

Таблица 2 - Результаты проверки ДНК S. nodorum с помощью наборов производства ООО «Агродиагностика»

Образец / тест

Ct, Fam

Ct, Hex

Результат

1 (ST)

 

33,5

-

2 (ST)

 

33,2

-

3 (ST)

 

33,1

-

4 (ST)

 

33,1

-

5 (ST)

 

33,3

-

6 (ST)

 

31,2

-

7 (SN)

15,6

 

+

8 (SN)

23,0

 

+

9 (SN)

18,2

 

+

10 (SN)

17,0

 

+

11 (SN)

21,8

 

+

12 (SN)

17,1

 

+

13 (SN)

18,1

 

+

14 (SN)

17,2

 

+

w (SN)

 

33,7

-

Как видно из таблицы, в пробах № 1-6 содержится ДНК S.tritici – результат отрицательный, № 7-14 содержится ДНК S. nodorum – результат положительный.

Таблица 3 - Результаты проверки ДНК S. tritici с помощью наборов производства ООО «Агродиагностика»

Образец / тест

Ct, Fam

Ct, Hex

Результат

1 (ST)

21,9

 

+

2 (ST)

22,0

 

+

3 (ST)

19,8

 

+

4 (ST)

25,6

 

+

5 (ST)

23,2

 

+

6 (ST)

23,1

 

+

7 (SN)

 

33,5

-

8 (SN)

 

33,5

-

9 (SN)

 

33,5

-

10 (SN)

 

34,1

-

11 (SN)

 

33,2

-

12 (SN)

 

33,5

-

13 (SN)

 

33,5

-

14 (SN)

 

33,2

-

w (SN)

 

33,7

-

Как видно из таблицы, в пробах № 1-6 содержится ДНК S.tritici – результат положительный, № 7-14 содержится ДНК S. nodorum – результат отрицательный.

По результатам ПЦР с применением набора ООО «Агродиагностика» праймеры строго специфичны видам септорий, на которые каждый праймер разработан. Далее проверяли специфичность разработанных праймеров с образцами ДНК выделенных из мицелия Septoria tritici и S. nodorum(рисунок 4 – 7).

Таблица 4 - Результаты ПЦР с праймерами к гену ITS1-2 на ДНК, выделенной из охарактеризованных образцов мицелия S. nodorum

Образец / тест

Ct, Fam

Результат

1 (ST)

 

-

2 (ST)

 

-

3 (ST)

 

-

4 (ST)

 

-

5 (ST)

 

-

6 (ST)

 

-

7 (SN)

17,6

+

8 (SN)

25,5

+

9 (SN)

21,8

+

10 (SN)

19,2

+

11 (SN)

23,6

+

12 (SN)

18,7

+

13 (SN)

21,1

+

14 (SN)

34,9

+

w (SN)

 

-

Как видно из таблицы, в пробах № 1-6 содержится ДНК S.tritici – ПЦР продукт не нарабатывается, в пробах № 7-14 где содержится ДНК S. nodorum – нарабатывается ПЦР продукт.

Таблица 5 - Результаты ПЦР с праймерами к гену ITS1-2 на ДНК, выделенной из охарактеризованных образцов мицелия S. tritici

Образец / тест

Ct, Fam

Результат

1 (ST)

25,1

+

2 (ST)

27,0

+

3 (ST)

23,8

+

4 (ST)

30,5

+

5 (ST)

30,1

+

6 (ST)

26,5

+

7 (SN)

 

-

8 (SN)

 

-

9 (SN)

 

-

10 (SN)

 

-

11 (SN)

 

-

12 (SN)

 

-

13 (SN)

 

-

14 (SN)

 

-

w (SN)

 

-

Как видно из таблицы, в пробах № 1-6 содержится ДНК S.tritici – результат положительный, № 7-14 содержится ДНК S. nodorum – результат отрицательный.

Таблица 6 - Результаты ПЦР с праймерами к гену бета-тубулина на ДНК, выделенной из охарактеризованных образцов мицелия S. nodorum

Образец / тест

Ct, Fam

Результат

1 (ST)

 

-

2 (ST)

 

-

3 (ST)

 

-

4 (ST)

 

-

5 (ST)

 

-

6 (ST)

 

-

7 (SN)

26,1

+

8 (SN)

25,3

+

9 (SN)

29,4

+

10 (SN)

25,5

+

11 (SN)

31,6

+

12 (SN)

26,1

+

13 (SN)

27,7

+

14 (SN)

26,6

+

w (SN)

 

-

Как видно из таблицы, в пробах № 1-6 содержится ДНК S.tritici – результат отрицательный, № 7-14 содержится ДНК S. nodorum – результат положительный.

Таблица 7 - Результаты ПЦР с праймерами к гену бета-тубулина на ДНК, выделенной из охарактеризованных образцов мицелия S. tritici

Образец / тест

Ct, Fam

Результат

1 (ST)

 

-

2 (ST)

31,1

+

3 (ST)

28,4

+

4 (ST)

 

-

5 (ST)

 

-

6 (ST)

29,8

+

7 (SN)

 

-

8 (SN)

 

-

9 (SN)

 

-

10 (SN)

 

-

11 (SN)

 

-

12 (SN)

 

-

13 (SN)

 

-

14 (SN)

 

-

w (SN)

 

-

Как видно из таблицы, в пробах № 1-6 содержится ДНК S.tritici – результат положительный, № 7-14 содержится ДНК S. nodorum – результат отрицательный.

Праймеры, подобранные нами к участку ITS1-ITS2 для детекции ДНК S. tritici и S. nodorum показали ту же специфичность, что и наборы производства ООО «Агродиагностика». При этом видно, что значение порогового цикла при использовании этих праймеров на 1-2 единицы выше, чем при использовании наборов ООО «Агродиагностика», что, однако не снижает чувствительноcти анализа. Причиной этого может являться худшее качество зонда и/или меньшая эффективность ПЦР.

Праймеры, подобранные нами к гену бета-тубулина для детекции ДНК S. nodorum показали те же показатели специфичности, что и наборы производства ООО «Агродиагностика», а при детекции S. tritici ДНК патогена детектируется лишь в 3 образцах вместо 5 при использовании праймеров к. При этом видно, что значение порогового цикла при использовании этих праймеров на 4-5 единиц выше, чем при использовании наборов ООО «Агродиагностика». Использование этих праймеров для диагностики мы сочли нецелесообразным. В дальнейшей работе использовали праймеры к локусу ITS1-ITS2: для

S. tritici - st_its550 - F st_tub1120 –R; для S. nodorum - sn_its130-F и sn_its550-R.

3.3 Экспериментальная проверка специфичности праймеров

Анализ специфичности разработанных праймеров проводился на образцах ДНК 68 моноспоровых штаммов грибов рода Septoria.

На рисунке 3 - в качестве примеров приведены электрофореграммы результатов ПЦР ДНК исследованных штаммов S. tritici иS.nodorum с праймерами st_its550 - F st_tub1120 –R; sn_its130-F и sn_its550-R.

Рисунок 3 - Электрофореграмма результатов ПЦР ДНК 68 моноспоровых штаммов грибов рода S. tritici (пробы №1-34)с праймерами st_its550 - F st_tub1120 –R; и S.nodorum (пробы № 35-68) с праймерами - sn_its130-F и sn_its550-R

На рисунке 3 имеются следующие обозначения: ВК – внутренний контроль, «спец. фрагм.» - полоса, соответствующая специфическому фрагменту, «-» - отрицательный контроль (вода).

В соответствии с рисунком 3 электрофореграммы демонстрируют абсолютную специфичность праймеров для S. tritici - st_its550 - F st_tub1120 –R; для S. nodorum - sn_its130-F и sn_its550-R.

Аналогичные результаты получены как при электрофоретическом анализе, так и в режиме ПЦР-РВ. По одному специфическому фрагменту для каждой пары праймеров было использовано для клонирования положительных контролей.

Препарат ДНК, подготовленный к ПЦР из биологического материала, может содержать примеси ингибиторов, заметно снижающих эффективность реакции, а в некоторых случаях и приводящих к отсутствию специфических ампликонов даже при наличии искомого возбудителя. Поэтому становится необходимым контролировать ход амплификации в каждой пробирке с реакционной смесью. При отсутствии регистрации внутреннего контроля и выявления специфической ДНК результат следует считать недостоверным.

В эксперименте кроме пары специфических праймеров использовался эндогенный внутренний контроль, служащий не только для оценки корректности ПЦР, но и для нормировки количественных значений концентраций специфической ДНК в пробах.

Размер продукта амплификации внутреннего контроля подбирали таким образом, чтобы он отличался от специфических ампликонов в 2 и более раз, чтобы исключить возможность отжига праймеров ВК вместе с ДНК септорий.

Важно отметить, что если в реакционной смеси находится нужная ДНК, то эффективность ее амплификации может заметно снижаться из-за конкуренции за праймеры с ДНК внутреннего контроля. Это особенно заметно при низких концентрациях ДНК в испытуемом образце и может приводить к ложноотрицательным результатам. Поэтому концентрацию внутреннего контроля рассчитывали так, чтобы не составлять конкуренции для амплификации даже единичных искомых молекул ДНК.

В связи с этим внутренний контрольный образец конструировали согласно следующим требованиям:

Амплификация ДНК внутреннего контрольного образца должна происходить и регистрироваться независимо от присутствия и количества искомой ДНК в реакционной смеси для всего диапазона определяемых концентраций, т.е. внутренний контрольный образец не должен быть конкурентным. Он представляет собой любой препарат ДНК, несхожий с ДНК искомого микроорганизма.

В качестве ВК использовали плазмидную конструкцию со вставкой размером 560 п.о., фланкированную инвертированными последовательностями, гомологичными праймеру, используемому для амплификации внутреннего контрольного образца.С этой целью в каждую пробирку при тестировании специфических праймеров в реакционную смесь также добавляли внутренний контроль.

3.4 Оценка эффективности проведения ПЦР-РВ, наличия ингибиторов в смеси и чувствительности реакции

Для оценки эффективности, чувствительности реакции и присутствия потенциальных ингибиторов в реакционной смеси использовали стандартную методику. Для этих целей проводили ПЦР-РВ последовательных десятикратных разведений специфической геномной ДНК. Каждая концентрация (в диапазоне от 101 до 106 пг ДНК на реакцию) была проанализирована в четырёх повторностях. На рисунке 4 приведен стандартный график зависимости значения Сq от количества копий специфической ДНК на реакцию для праймеров S. tritici - st_its550 - F st_tub1120 –R (рисунок 4-А); S. nodorum - sn_its130-F и sn_its550-R (рисунок 4 -Б)

Рисунок 4 - Стандартный график зависимости Сq от концентрации ДНК в пробе (logC) для праймеров S. tritici - st_its550 - F st_tub1120 –R (А); S. nodorum - sn_its130-F и sn_its550-R (Б)

Чувствительность тест-систем составила порядка 10 пг специфической ДНК на реакцию, что составляет около 200 копий с учётом размера генома грибов рода Septoriа порядка около 36 млн. п.о.

Эффективность проведения ПЦР определяли экспериментально путём последовательных разведений образца анализируемой ДНК. Каждое разведение было проанализировано в нескольких повторностях. Для каждого образца определяли Сqи строили график линейной зависимости в координатах log[CДНК]/Сq. График описывается уравнением линейной функции y = -kx+b. При этом коэффициент k с отрицательным знаком показывает количество циклов, за которое происходит увеличение флуоресцентного сигнала на порядок, а 1/k – порядок изменения количества ДНК за 1 цикл ПЦР. Поскольку эффективность представляет собой изменение количества ДНК в одном цикле, то вычислить её можно, возведя 10 в степень 1/k.

Эффективность реакции составляла в экспериментах 96%, что является весьма высокими значениям эффективности для систем ПЦР-диагностики.

3.5 Детекция S. tritici иS.nodorumв проростках пшеницы на ранних стадиях заражения

С целью изучения возможности использования разработанных праймеров в формате ПЦР-РВ для экспресс-диагностики возбудителей септориоза совместно с сотрудниками лаборатории Института биоорганической химии им. академиков М.М. Шемякина и Ю.А. Овчинникова РАНН был проведен анализ искусственно зараженных грибами S. tritici иS.nodorum проростков пшеницы. Целью данного исследования было установление возможности детекции гриба, который вызывает септориоз злаковых, в растительном материале на ранней стадии заражения, а также поиск корреляции между уровнем распространения болезни и сигналом ПЦР.

Семена пшеницы сорта Энита инокулировали патогеном путем погружения их на 15 мин в суспензию спор (106 спор/мл), зараженные семена раскладывали на полосках фильтровальной бумаги (ГОСТ Р 50459-92) и дополнительно инокулировали нанесением 250 мкл суспензии в зону зародыша. В качестве контроля были использованы проростки из семян, обработанных стерильной дистиллированной водой. Каждая обработка включала 100 проростков. Для исследования с использованием ПЦР-РВ были взяты 3 серии образцов: незараженные (контроль), а также образцы, содержавшие 10, 50 и 100% зараженных проростков (далее обозначены как «Заражение 10%, Заражение 50% и Заражение 100%). Образцы отбирали на 3 и 7 дни после заражения. Через 12 дней после заражения распространенность болезни (число пораженных проростков) оценивали с помощью рекомендованного для фитопатологической экспертизы «рулонного» метода (ГОСТ Р 50459-92).

Основной целью применения такого контроля было установление точных соотношений количеств ДНК гриба и растения во всех сериях. В отсутствии специфической пары праймеров ДНК пшеницы амплифицировалась парой праймеров WhEFGF-R с высокой эффективностью (98.5%); чувствительность метода составила около 1 нг ДНК пшеницы на реакцию (что соответствует примерно 50 копиям).

С помощью такой системы возможно установление точного соотношения количества ДНК гриба и ДНК растения. В таблице 8 приведены результаты ПЦР-РВ (Сq) со всеми сериями образцов на 3 и 7 день после заражения.

Таблица 8 - Результаты ПЦР-анализа ДНК искусственно заражённых грибом Septoriaпроростков пшеницы. FAM – специфический образец, HEX – внутренний контроль, K+ - положительный контроль, К - отрицательный контроль

3 день п/з

Сq FAM

Cq НЕХ

7 день п/з

Сq FAM

Cq НЕХ

Незараженный

-

+ (27.5)

Незараженный

-

+ (27.3)

Заражение 10 %

+ (32.5)

+ (27.1)

Заражение 10 %

+ (34.0)

+ (28.0)

Заражение 50 %

+ (34.7)

+ (27.4)

Заражение 50 %

+ (26.6)

+ (27.6)

Заражение 100 %

+ (35.2)

+ (27.8)

Заражение 100 %

+ (23.9)

+ (27.5)

K+

+ (22.0)

+ (26.9)

K +

+ (21.5)

+ (27.0)

К-

-

+ (26.7)

K-

-

+ (26.9)

На рисунке 5 продемонстрированы соотношения определённых по результатам ПЦР-РВ количеств ДНК гриба (пг) и пшеницы (нг) (в расчёте на 1 нг пшеницы) для разных образцов разных серий.

Рисунок 5 - Соотношения количеств ДНК гриба и пшеницы для трёх серий образцов (log (пг ДНК Septoria/нг ДНК пшеницы)

На рисунке к левые столбики – результат на 3 день после заражения, правые столбики – 7 день после заражения.

На 3 день после заражения количество ДНК практически постоянно везде вне зависимости от количества заражённых проростков. Возможное объяснение этому факту – то, что на 3 день интенсивный рост гриба ещё не начался и его количество остаётся практически неизменным во всех образцах. На 7 день после заражения видна чёткая корреляция между количеством заражённых проростков и интенсивностью сигнала ПЦР. Количество ДНК в серии «50%» выше, чем в серии «10%», почти на 3 порядка, в свою очередь, в серии «100%» выше, чем в серии «50%» десятикратно.

Проведённый опыт показал несомненные преимущества использования метода ПЦР, и, в частности, ПЦР-РВ для диагностики септориоза на ранних, бессимптомных стадиях заражения, поскольку методы фитопатологической экспертизы позволяют идентифицировать патоген лишь на 12-14 сутки после заражения, они трудоёмки и занимают много времени. Разработанные тест-системы более эффективны и чувствительны, чем используемые на сегодняшний день классические методы, и перспективны для использования в лабораториях и организациях, занимающихся фитосанитарным контролем и оценкой качества продуктов питания.

ЗАКЛЮЧЕНИЕ

В результате проведенных исследований за 2014 год получены следующие результаты:

1. Разработаны видоспецифичные праймеры и зонды к S.tritici:

st_its180 – F ACACTGCATCTCTGCGTCGGA

st_its550–R CGAGGTCAACCTGAGGTGTGATTT;

stn_its330 FAM-TCGAATCTTTGAACGCACATTGCGC-BHQ1

Разработаны видоспецифичные праймеры и зонды к S.nodorum:

sn_its130–FTACCCACGTTTCCTCGGCAG,

sn_its550 CTGATCCGAGGTCAAAAGTTAGAAA;

stn_tub1190 FAM-TCGAATCTTTGAACGCACATTGCGC-BHQ1.

Получен внутренний контрольный образец. В качестве ВК использовали плазмидную конструкцию со вставкой размером 560 п.о., фланкированную инвертированными последовательностями, гомологичными праймеру, используемому для амплификации внутреннего контрольного образца.Для проведения экспериментов получен положительный контрольный образец. По одному специфическому фрагменту для каждой пары праймеров было использовано для клонирования положительных контролей Разработка положительного контрольного образца является задачей следующего этапа.

Проверена специфичность подобранных праймеров и зондов методом ПЦР в «реальном времени» на ДНК, выделенной из культур Septoria tritici и Stagonospora nodorum

2. Отработаны и оптимизированы параметры ПЦР

На основании выбранных в процессе экспериментов оптимальных параметров времени и температур для всех стадий амплификации, был составлен следующий режим для проведения ПЦР:

пре-денатурация: 1 мин, 94 0С

денатурация: 10 с, 94 0С

отжиг: 20 с, 64 0С 50 циклов

синтез: 20 с, 67 0С

хранение 10 0С

Амплификацию проводили на приборе ДТ-96.

Состав реакционной смеси включал:

18 мкл 1,25х буфера для ПЦР,

0,24 мкл 25 мМ dNTPs,

0,125 мкл каждого праймера (100 мкМ),

0,14 мкл зонда (50 мкМ),

10 мкл раствора Taq-полимеразы,

5 мкл раствора ДНК.

Эффективность проведения ПЦР определяли экспериментально путём последовательных разведений образца анализируемой ДНК.

3. Определены специфичность и чувствительность ПЦР с разработанными праймерами.

Анализ специфичности разработанных праймеров проводился на образцах ДНК 68 моноспоровых штаммов грибов рода Septoria. Приведённые в отчете электрофореграммы демонстрируют абсолютную специфичность праймеров к S.tritici st_its180 – F и st_its550–R и к S. nodorum: sn_its130–F

Чувствительность тест-систем составила порядка 10 пг специфической ДНК на реакцию, что составляет около 200 копий с учётом размера генома грибов рода Septoriа порядка около 36 млн. п.о.

СПИСОК ИСПОЛЬЗОВАННЫХ ИСТОЧНИКОВ

1 И. М. Поляков, Е. М. Шумаков. Защита растений. - М.: Советская энциклопедия. – 1969-1978.

2 Stephen B. Goodwin, Theo A.J. van der Lee, Jessica R. Cavaletto, Bas te Lintel Hekkert, Charles F. Crane, Gert H.J. Kema, Identification and genetic mapping of highly polymorphic microsatellite loci from an EST database of the septoria tritici blotch pathogen Mycosphaerella graminicola / Fungal Genetics and Biology, Volume 44, Issue 5, May 2007, Pages 398-414.

3 Nicolas Feau, Jerry E. Weiland, Glen R. Stanosz, Louis Bernier, Specific and sensitive PCR-based detection of Septoria musiva, S. populicola and S. populi the causes of leaf spot and stem canker on poplars / Mycological Research, Volume 109, Issue 9, September 2005, Pages 1015-1028.

4 Zhonghua Ma, Themis J. Michailides, Approaches for eliminating PCR inhibitors and designing PCR primers for the detection of phytopathogenic fungi / Crop Protection, Volume 26, Issue 2, February 2007, Pages 145-161.

5 Fraaije B. A. – Hollomon, D. W. 1997. Novel DNA diagnostic technology in plant disease control using Septoria tritici as a model. In: Project report no. 245, IACR-Long Ashton Research Station, Bristol 1997, 27 p.

6 Kendall, S.J. – Hollomon, D.W. – Selley, A. 1998. Immunodiagnosis as an aid to the timing of fungicide sprays for the control of Mycosphaerella graminicola in winter wheat in the UK. In: Proc. Of Brighton Crop Protection Conference-Pests and Diseases 1998, vol. 2, p. 701-706.

7 Welland, J.J. – Steffenson, B.J. – Cartwright, R.D. – Webster, R.K. 1999. Identification of molecular genetic markers in Pyrenophora teres f. sp. teres associated with low virulence on .Harabin.barley. In: Phytopathology 1999, vol. 89, p. 176-181.

8 Williams, K.J. – Smyl, C. – Lichon, A. – Wong, K.Y. – Wallwork, H. 2001. Development and use of an assay based on the polymerase chain reaction that differentiates the pathogens causing spot form and net form of net blotch of barley. In: Austral. Plant Pathol. 2001, vol. 30, p. 37-44.

9 Acta fytotechnica et zootechnica, Vol. 7, 2004, Special Number, Proceedings of the XVI. Slovak and Czech Plant Protection Conference organised at Slovak Agricultural University in Nitra, Slovakia.

10 Биоорганическая химия, 2008, том 34, № 1, с. 107-113.

11 Генная инженерия растений. Лабораторное руководство / под ред. Дж. Дрейпера, Р. Скотта, Ф. Армитиджа, Р. Уолдена. – М.: Мир, 1991. 124 с.

Просмотров работы: 4106