ПОЛИМОРФИЗМ ГЕНОВ РЕПАРАЦИИ ДНК – XRCC1 И XRCC3 В КАЗАХСТАНСКОЙ ПОПУЛЯЦИИ. - Студенческий научный форум

VI Международная студенческая научная конференция Студенческий научный форум - 2014

ПОЛИМОРФИЗМ ГЕНОВ РЕПАРАЦИИ ДНК – XRCC1 И XRCC3 В КАЗАХСТАНСКОЙ ПОПУЛЯЦИИ.

Ондыбаева С.Б. 1, Кусаинова А.К. 2, Булгакова О.В. 2
1Евразийский национальный университет им Л.Н.Гумилева
2Евразийский национальный университет имени Л.Н. Гумилева
 Комментарии
Текст работы размещён без изображений и формул.
Полная версия работы доступна во вкладке "Файлы работы" в формате PDF

Рак легкого (РЛ) занимает лидирующие позиции в структуре онкологической заболеваемости мужчин, которые болеют почти в 7 раз чаще, чем женщины [1]. Согласно данным международного агентства по изучению рака, ежегодно в мире регистрируется около 1 миллиона новых случаев рака лёгких, 60 % онкологических больных погибает в результате данного заболевания [2].

Основными причинами канцерогенеза является сбой в системе контроля за процессами пролиферации, репарации ДНК, апоптоза и детоксикации канцерогенных веществ, вызванные не только генетическими и эпигенетическими нарушениями, но и вариабельностью функционирования генов, обусловленной генетическим полиморфизмом [3].

Есть несколько генетических полиморфизмов генов, продукты которых вовлечены в механизмы репарации ДНК [4]. Фермент XRCC1 играет ключевую роль в эксцизионной репарации ДНК [5].

Описано три кодирующих полиморфизма в гене XRCC1 в кодонах 194 (Arg to Trp), 280 (Arg to His), и 399 (Arg to Gln). Полиморфизм Arg399Gln 10 экзона затрагивает его центральный домен, необходимый для активации BER (base excision repair). Есть сведения что данный полиморфизм связан c риском развития рака легких [6], однако анализ литературных данных показал достаточно противоречивые результаты ассоциации Arg399Gln полиморфизма с раком легких [7].

Что же касается полиморфизмов Arg194Trp и Arg280His, не было обнаружено связи с риском рака легких для европейской популяции [8]. Ван и др. провели 30 исследований полиморфизма XRCC1 Arg399Gln методом случай-контроль и 16 исследований полиморфизма Arg194Trp. Их результаты показали, что конкретные кодоны XRCC1 399 и 194 могут негативно влиять на предрасположенность к раку легких [9].

В процессах репарации двунитевых разрывов ДНК и рекомбинационной репарации ДНК вероятно участвует XRCC3 [10, 11, 12]. Двунитевые разрывы ДНК - наиболее распространенная форма повреждений ДНК вызванная радиационным воздействием, репарация возможна по средствам двух механизмов - репарации гомологичной репарации (HRR - homologous recombination repair) и репарации негомологичных концов (no homologous end-joining). Механизм HRR состоит, по крайней мере, из 16 белковых компонентов, включая XRCC3. Полиморфизм в 7 экзоне XRCC3 приводит к замене аминокислоты в кодоне 241 (Thr241Met), который может затронуть функцию фермента и/или взаимодействие с другими белками, вовлеченными в репарацию повреждений ДНК [13]. Во многих литературных источниках говорится о значительном снижении риска развития рака легких в европейской популяции для носителей полиморфизма XRCC3 T241M. Однако, исследования данного полиморфизма, проведенные в азиатских популяциях не выявили достоверной ассоциации между XRCC3 T241M и развитием рака легких.

Можно предположить что, несогласованность этих результатов может лежать в основе различий в этнической принадлежности, образе жизни и распространении болезни [8].

В связи с вышеизложенным, нами была поставлена цель – изучить популяционные особенности полиморфизма генов репарации ДНК (XRCC1 и XRCC3) в казахстанской популяции здоровых людей, выбранных в качестве контрольной группы для изучения роли полиморфизма генов XRCC1 и XRCC3 в патогенезе развития рака легких .

В исследование были включены 70 добровольцев без патологии легких. Из всех обследованных 73% составили мужчины, 27% - женщины, возрастной интервал составил от 42 до 80 лет (60,2±8,6 лет).

Геномная ДНК была выделена из цельной венозной крови с последующей фенольно-хлороформной экстракцией (Дейвис К., 1990).

Оценка полиморфизмов генов проводилась с помощью ПЦР и ПЦР-ПДРФ-анализа (условия см. таблица 1). Визуализация продуктов ПЦР-ПДРФ реакции проводилась методом гель-электрофореза. Продукты амплификации или рестрикции анализировали в агарозном или полиакриламидном геле. Использовали 2% агарозный гель. Таблица 1. Условия анализа полиморфизма локусов изучаемых генов

Ген

Последовательность праймеров

Температура

отжига (°C)

Ферменты рестрикции

XRCC1 Arg194Trp

5´GCCCCGTCCCAGGTA3´,

5´AGCCCCAAGACCCTTT3´

57

PvuII

XRCC1 Arg399Gln

5´CAAGTACAGCCAGGTCCTAG3´,

5´CCTTCCCTCACTGGAGTAC-3´

55

NciI

XRCC3 Thr241Met

5´GCCTGGTGGTCATCGACTC3´

R 5´ACAGGGCTCTGGAAGGCACT

GCTCAGCTCACGCACC-3´

60

NcoI

Распределение частот генотипов гена XRCC1 Arg194Trp в казахстанской популяции было следующим: гомозиготные носители нормальной аллели Arg/Arg составили 73% от общего числа (51/70), гетерозиготы Arg/Trp 16% (11/70) и гомозиготы по мутантной аллели Trp/Trp 11% (8/70) соответственно.

Таким образом, полученные данные говорят о преобладании варианта нормальной аллели Arg/Arg в контрольной группе, представленной здоровыми людьми без патологии легких. На рисунке 1 представлены результаты ПЦР-ПДРФ-анализа на полиморфизм XRCC1 Arg194Trp.

Рисунок 1 - Примеры идентификации генотипов по гену XRCC1 Arg194Trp

Дорожки 3,5,8 представляют гетерозиготный вариант Arg/Trp (длина фрагментов после рестрикции 490/294/196 b.p.).

В случае полиморфизма гена XRCC1 Arg399Gln гомозиготные носители нормальной аллели Arg/Arg составили 37% от общего числа (26/70), гетерозиготы Arg/Gln 26% (18/70) и гомозиготы по мутантной аллели Gln/Gln 37% (26/70) соответственно.

Таким образом, в контрольной группе здоровых людей оказалось равное количество носителей как нормальной аллели Arg/Arg, так и мутантной аллели Gln/Gln.

В казахстанской популяции гомозиготные носители нормальной аллели XRCC3 Trp/Trp составили 26% от общего числа (18/70), гетерозиготы Trp/Met 72% (50/70) и гомозиготы по мутантной аллели Met /Met 2% (2/70). Полученные данные говорят о преобладании варианта гетерозиготной аллели Trp/Met в контрольной группе, представленной здоровыми людьми без патологии легких.

На рисунке 2 представлены результаты ПЦР-ПДРФ-анализа на полиморфизм XRCC3 Thr241Met.

Рисунок 2 - Примеры идентификации генотипов по гену XRCC3 Thr241Met

Дорожки 2, 8 представляют гомозиготный мутантный вариант Met /Met (длина фрагментов после рестрикции 97/39 b.p.); 3,7,9,10 дорожки – гомозиготная нормальная аллель Trp/Trp (136 b.p.); дорожки 4,5,6 – гетрозиготная аллель Trp/Met (длина фрагментов после рестрикции 136/97/39 b.p.)

  1. Perera FP (1998). Molecular epidemiology of environmental carcinogenesis. Recent Results Cancer Res, 154, 39-46.

  2. Raunio H, Husgafvel-Pursiainen K, Anttila S, et al (1995). Diagnosis of polymorphisms in carcinogen-activating and inactivating enzymes and cancer susceptibility-a review. Gene, 159, 113-21.

  3. Malik, Brown, 2000; Singletary, 2003; Yokota, Kohno, 2004; Hunter, Crawford, 2006.

  4. Perera FP (1998). Molecular epidemiology of environmental carcinogenesis. Recent Results Cancer Res, 154, 39-46.

  5. Kubota Y, Nash RA, Klungland A, Scha¨ r P, Barnes DE, et al. (1996) Resconstitution of DNA base excision repair with purified human proteins: Interaction between DNA polymerase beta and the XRCC1 protein.EMBO J 15:6662–70.

  6. Hao B, Miao X, Li Y, Zhang X, Sun T, et al. (2006) A novel T–77C polymorphism in DNA repair gene XRCC1 contributes to diminished promoter activity and increased risk of non-small cell lung cancer. Oncogene 25:3613–20.

  7. Egger M, Smith DG, Schneider M, Minder C (1997)Bias in meta-analysis detected by a simple, graphical test. BMJ 315:629–34.

  8. Higgins JPT, Green S (2008) Cochrane handbook for systematic reviews of interventions version 5.0.1. The Cochrane Collaboration, Oxford

  9. Wang Y, Yang H, Li H, Li L, Wang H, et al. (2009) Association between X-ray repair cross complementing group 1 codon 399 and 194 polymorphisms and lung cancer risk: a meta-analysis. Cancer Lett 285:134–40.

  10. Shin A, Lee KM, Ahn B, Park CG, Noh SK, et al. (2008) Genotype-phenotype relationship between DNA repair gene genetic polymorphisms and DNA repair capacity. Asian Pac J Cancer Prev 9:501–5.

  11. Tebbs RS, Zhao Y, Tucker JD, Scheerer JB, Siciliano MJ, et al. (1995) Correction of chromosomal instability and sensitivity to diverse mutagens by a cloned cDNA of the XRCC3 DNA repair gene. Proc Natl Acad Sci USA 92:6354–8.

  12. Thacker J, Zdzienicka MZ (2004) The XRCC genes: expanding roles in DNA double-strand break repair. DNARepair (Amst.) 3:1081–90.

  13. Kuschel B, Auranen A, McBride S, Novik KL, Antoniou A, et al. (2002) Variants in double-strand break repair genes and breast cancer susceptibility. Hum Mol Genet 11:1399–440.

Просмотров работы: 1614